Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa

摘要

Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot(A (R)) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0 %, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5 %, respectively.