Screening for genetic polymorphism for Vitamin D receptor gene for predisposition for osteoarthritis

摘要

A method of diagnosis for predisposition or susceptibility to osteoarthritis comprising of determining the presence or absence of a polymorphic risk version of a vitamin D receptor gene in an animal. The polymorphic risk version of the gene being one that does not contain a cleavage site for restriction enzyme TaqI. The method comprises of using PCR techniques to amplify a fragment of exon 9 of the vitamin D receptor gene. The PCR primers used are: 1. CAGAGCATGGACAGGGAGCAAC (3') 2. GCAACTCCTCATGGCTGAGGTCTC (3') to amplify a 740 base pair fragment of exon 9 of Vitamin D receptor gene.