Detecting human papilloma virus, useful for diagnosing infection particularly by oncogenic types, comprises nested polymerase chain reaction with consensus primers

摘要

Amplifying HPV (human papilloma virus) DNA (I) in a sample, comprising optionally digesting the sample with protease, isolating nucleic acid, performing two-step (nested) polymerase chain reaction (PCR) and optionally purifying the resulting amplicons, is new. The PCR uses 15-25 base primers with sequences complementary to consensus sequences within the L1 gene region of at least 30 HPV types. Independent claims are also included for the following: in vitro detection of HPV by amplification using the novel method, then detecting amplicons by hybridization with one or more probes; (1) kits for performing the novel amplification method; (2) flat carriers, divided optically into many fields, with each field supporting an oligonucleotide probe complementary to a sequence specific for a particular HPV type or to a consensus region of HPV DNA; (3) oligonucleotide probes of formulae (i)-(iv), or their pairs or mixtures AGGATGGKGATATGGT (i), GTATCWACMACAGTAACAAA (ii), TGYAAATATCCWGATTAT (iii), TGTARCCAATATGGYTTATT (iv); and (4) oligonucleotide probes of formulae (v)-(xii) or their fragments TAGTGGAAATCGCACGTCTGTAGGGAGTAGTAT (v), GGGGGTAATAACAGATCATCTGTAGCTAGTAG (vi), CTCTGGGTCTACTGCAAATTTAGCCAGTTCAAA (vii), CACAGGTATGCCTGCTTCACCTGGCAGCTGTGT (viii), CTCCGGTTCAACAGCTACTTTAGCTAACAGTAC (ix), TTCAGGAACTACTGCCTCTATTCAAAGCAGTGC (x), GAACAAATGTTTGYWAGACATTTTTTAAY (xi), GAGCAGCTTTTTGCTAGGCATTTTTGGAATAG (xii). K = G or T; W = A or T; M = A or C; Y = C or T; R = G or A.