New recognition molecules for the vascular endothelial growth factor gene, useful for treatment, diagnosis and monitoring of solid tumors and leukemia

摘要

Recognition molecule (I), directed against the gene for vascular endothelial growth factor (VEGF) is new. It interacts specifically with the mRNA of VEGF in the target sequence region 600-990 of M 32977. An independent claim is also included for pharmaceutical compositions, kits and/or arrays that contain (I). ACTIVITY : Cytostatic. MECHANISM OF ACTION : Inhibiting expression of vascular endothelial growth factor (VEGF). Treatment with (I) (a) increases sensitivity of tumor cells to cytostatic agents or radiation and (b) inhibits vitality and proliferation potential of cells, leading to cell-cycle arrest. The antisense oligonucleotide tggtgtggtggcggcagcgt complementary to region 732-742 of the mRNA for VEGF, was used to transfect the human bladder cancer cell line EJ28. This treatment reduced the cellular content of VEGF (protein) by more than 60% relative to a nonsense oligonucleotide and also reduced cell viability, causing death of almost all the cells.