Identification method of Candida parapsilosis sensu stricto, Candida orthopsilosis and Candida metapsilosis yeast

摘要

object predklu00e1danu00e9ho solving is way identification of yeast candida parapsilosis sensu stricto, candida orthopsilosis and / or candida metapsilosis,in which with isolated dna test of micro organism by multiplex polymerase retezovu00e1 ci smesi reaction (multiplex pcr) with a primer pouzitu00edm aagtcaactgattaactaatag,aaggatcattacagaaatagga, ttggtaggccttctatatgg and ctttggaataccaaagggc and figure below shall be the product polymeru00e1zovu00e9 retezovu00e9 electrophoresis multiplex reactions.furthermore, a solution includes pouzitu00ed primer for identification to species of yeast, and oligonucleotides.