Method for the simultaneous genetic diagnosis of two mutant alleles causing CVM and BLAD in cattle and a test system for its implementation

摘要

1. A method for the simultaneous genetic diagnosis of two mutant alleles that cause CVM and BLAD in cattle, involves the extraction of DNA from biological material, the formulation of the polymerase chain reaction in real time, using the reaction mixture with CVM / BLAD containing all the necessary reagents for PCR PB, diluent, Taq DNA polymerase, three positive and one negative control sample, in preparation for the reaction, the required volume of components is calculated based on the number of samples studied Cts plus 4, the reagents are mixed, then 20 μl of the prepared PCR mixture are added to the prepared PCR tubes, 5 μl of control and test samples are added to each PCR tube, the tubes are placed in an amplifier, the primers are annealed at the cycling stage at 64 ° С within 30 s with the number of amplification cycles equal to 40, the analysis of the obtained data is carried out by comparing the amplified regions of the genes, the results are interpreted based on the presence or absence of the intersection of the fluorescence curve with the corresponding uyuschem level threshold liniey.2. The test system for implementing the method according to claim 1 by the method of formulation of the polymerase chain reaction in real time, characterized in that it includes a CVM / BLAD reaction mixture containing all the necessary reagents for PCR RV, namely 50 mMKCl, 50 mMTRIS-HCl, 250 nMdNTP, 2.5 mMMgCl, primers at a concentration of 200 nM, allele-specific probes at a concentration of 100 nM, having the following sequences: CVM_up - gattctcaagagcttaattctaaggaCVM_low - aagtaaaccccagcaaagccacCVM_Wt - (FAM) aggctctcgtctcgctctgtgtgtgtgtgtgtgtgtgtgtgtag (BHQ2), BLAD_up - ttaggcagttgcgttcBLAD_low - acgttgacgaggtcatccacca, BLAD_Wt - (ROX) accccatcgacctgtacta- (BHQ1), BLAD_m (Cy5 ) ccatcggcctgtactacct- (BHQ2), diluent, 2.5 units Taq DNA polymerase, 3 positive controls, one negative control.