Pair of starter oligonucleotides for molecular detection of dwarfism gene Dw 1 in rye plants and method for molecular detection of the presence of dwarfism gene Dw 1 in rye plants

摘要

the object of the application is oligonukleotydowych pair primers for molecular detection karu0142owatou015bci dw1 gene in plants of rye,about sequences: forward 5 '- 3' agctagggtttacgccgttc reverse - 5 'cggcaagaggtttgcactc - 3'.in addition, the application also contains way molecular detection karu0142owatou015bci dw1 gene in plants of rye,in which the polymorphic dna fragment coupled with the gene amplifikowany in pcr reaction using a pair of primers, which are detection of amplification.way is characterized by the fact that few primers is a pair of forward oligonukleotydowych primers sequences 5 '- 3' agctagggtttacgccgttc reverse - 5 'cggcaagaggtttgcactc - 3',using marker h - 032.