class="head no_bottom_margin" id="sec6title">IntroductionThe clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) system is a unique adaptive immunity mechanism of bacteria and archaea that mediates defense against invasion by foreign microbes (). Currently, six types of CRISPR-Cas systems (I–VI) have been identified (, , ). Among them, the type I, II, and V systems consist of several subtype-specific genes (A–D and U of type I; B and C variants of type II, and A, B, and E of type V) (). These systems also include a variety of Cas proteins, including Cas4, which form complexes that mediate the recognition of foreign DNA sequences (, ).Notably, in a recent study, a CRISPR-like mimivirus virophage resistance element (MIMIVIRE) system, which consists of a cascade of genes and a CRISPR array, was reported to protect mimiviruses against virophages () (). Specifically, this system functions similarly to the Cas proteins and interferes with virophage invasion () (). The nuclease R354, a putatively functional homolog of Cas4 involved in spacer processing for adaption to foreign DNA (, , ), was found to be essential for MIMIVIRE function.target="object" href="/pmc/articles/PMC6137704/figure/fig1/?report=objectonly">Open in a separate windowclass="figpopup" href="/pmc/articles/PMC6137704/figure/fig1/" target="figure" rid-figpopup="fig1" rid-ob="ob-fig1">Figure 1The MIMIVIRE Defense System(A) Schematic representation showing the prokaryotic CRISPR-Cas system, which is representative of the type II-B system; all components are highlighted in different colors (href="#bib4" rid="bib4" class=" bibr popnode">Hudaiberdiev et al., 2017, href="#bib5" rid="bib5" class=" bibr popnode">Koonin et al., 2017).(B) Schematic representation showing the viral MIMIVIRE system. Zamilon, a novel virophage, was reported to infect giant viruses from the Mimiviridae family. A specific 28-nucleotide-long sequence in some mimivirus genomes was defined to be identical to the fragment DNA sequence of Zamilon; this pattern is similar to the CRISPR-Cas system, and the unique sequence was named Zamilon. The inserted 28-nucleotide-long sequence is AATCTGATAATGAATCTGATAATGAATC, and the derived 15-nucleotide repeated unit is TGATAATGAATCTGA (href="#bib1" rid="bib1" class=" bibr popnode">Brouns et al., 2008, href="#bib2" rid="bib2" class=" bibr popnode">Gaia et al., 2014).
展开▼
