MODIFIED ANTISENSE OLIGONUCLEOTIDE AGAINST SARS-CoV-2

摘要

FIELD: molecular biology.;SUBSTANCE: invention relates to molecular biology. Described is modified antisense oligonucleotide against an RNA region near the 5' end of the SARS-CoV-2 virus causing the disease with the new coronavirus infection COVID-19, characterized by a 5`–AGCCGAGTGACAGCCACACAG nucleotide sequence that inhibits virus replication. To increase the resistance of an antisense oligonucleotide as a modification of at least one sugar-phosphate residue of the side chain, a modification from the group: phosphorothioate, thiophosphoramide, morpholine, peptide-nucleic, 2`-O-methyl, 2`-O-methoxyethyl, ethylene bridge, LNA is used. The use of this antisense oligonucleotide in Vero E6 cell culture showed low toxicity of the drug - the cytotoxic dose (CC50) was greater than 2 mg/ml, and the antiviral activity at a dose of 1 mg/ml showed a decrease in the viral load by 5.3-13 times. The invention can be used to block the expression of RNA near the 5' end of the genome of the SARS-CoV-2 virus, which causes the new coronavirus infection COVID-19 disease.;EFFECT: proposed invention ensures highly specific binding of the claimed antisense oligonucleotide to RNA with a known sequence of nucleotides near the 5' end of the genome of the SARS-CoV-2 virus.;2 cl, 4 tbl, 1 ex