Fast DNA assay for the detection of chinolon resistant staphylococcus aureus in clinical material

摘要

Primers for amplification and specific detection of point mutations in Gyrase A are new: (i) for detecting C/T mutation at position 2533: (1) and (4); (ii) for detecting T/G mutation at position 2532: (2) and (4); and (iii) for detecting G/A mutation at position 2544: (3) and (4). ATCACCCTCATGGTGACTT (1); ATCACCCTCATGGTGACE (2); ATGGTGACTCATCTATTTATA (3); GTCCGCCTCCACGTTCTT (4) Also new are: (A) oligonucleotide probe (5), opt. labelled, that hybridises with DNA or RNA of quinolone-resistant Staphylococci: GTACGTATGGCTCAAGATTTCAGTTATCGTTATCCG (5); and (B) a polynucleotide probe (6; sequence of 534 bp reproduced in the specification), or its fragments, opt. labelled, that hybridises as (5).