Detecting Staphylococcus by nucleic acid amplification, useful for testing e.g. clinical samples, can identify simultaneously enterotoxin and methicillin-resistance genes

摘要

Method for detecting Staphylococcus DNA (I) in a sample by nucleic acid amplification in which the primers are 10 specified sequences (A) or their variants. (A) have formulae: TTATTCATTGCCCTAACGT (1) AGCACCATATAAGTCTACT (2) CT5GGGAATGTTGGAT (3) CCWCCATACATACAAGTTT (4) GTGAGCAAGTTGGATAGA (5) GAGCACCTTTAAATGATTCT (6) TTCAGCAGACAGATGAAGA (7) GTAAATGTGCCACGCAT (8) AGCTGAAGAAACAACACA (23) CGCTTCATATCCAAATGT (24) Independent claims are also included for the following: (a) composition comprising (A) or their variants; and (b) test kit for detecting (I) comprising (A) or their variants.