SiRNA with increased stability in serum

摘要

Targeted selection of double-stranded RNA (I) with increased activity for inhibiting expression of a target gene, is new. Targeted selection of double-stranded RNA (I) with increased activity for inhibiting expression of a target gene. The individual strands of (I) are chosen so that at both ends of (I) the last complementary pair is G-C or at least 2 of the last 4 complementary pairs are G-C; (I) has, at a first end, a single-stranded overhang of 1-4 unpaired nucleotides (nt) but no overhang at the second end; and the nt in the overhang that is attached to the last complementary pair contains a purine base. The following RNAs are excluded: 5'- CAGGACCUCGCCGCUGCAGACC 3'-CGGUCCUGGAGCGGCGACGUCUGG 5'- GCCUUUGUGGAACUGUACGGCC 3'-UACGGAAACACCUUGACAUGCCGG 5'-CUUCUCCGCCUCACACCGCUGCAA 3'-GAAGAGGCGGAGUGUGGCGACG 5'- ACGGCUAGCUGUGAAAGGUCC 3'-AGUGCCGAUCGACACUUUCCAGG 5'- CAAGGAGCAGGGACAAGUUAC 3'-AAGUUCCUCGUCCCUGUUCAAUG. An independent claim is also included for (I),other than those excluded above, as new compounds. ACTIVITY : None given. MECHANISM OF ACTION : RNA interference with gene expression. No biological data is given.