The recombinant plasmid DNA pVar 15-HIV-LTR, cloned genomic fragments SUPPORTING HIV-1 type from conserved regions of 5'-LTR Sequences, recombinant plasmid DNA pBluKSM-HIV-LTR mod, CARRIER cloned modified fragment of the same part of the HIV genome type 1 test KIT FOR RAPID IDENTIFICATION OF QUANTITATIVE genome of HIV-1 in the sample ANY KIND AND METHOD with its use

摘要

1. u0440u0435u043au043eu043cu0431u0438u043du0430u043du0442u043du0430u00a0 u043fu043bu0430u0437u043cu0438u0434u043du0430u00a0 dna pVar15 - hiv - LTR, u043du0435u0441u0443u0449u0430u00a0 cloned a fragment of the genome of human immunodeficiency virus type 1 from the conservative site 5 '- LTR - follower for the size of 4561 u043f.u043d. and u043cu043eu043bu0435u043au0443u043bu00a0u0440u043du043eu0439 mass 3 mda, u0432u043au043bu044eu0447u0430u044eu0449u0430;BamHI / EcoRI - a fragment of a vector plasmid pVar15 [9], the size of the units; u043f.u043d.;BamHI / EcoRI to a dna fragment of the 5 '- LTR conservative sequence of human immunodeficiency virus type 1 the size of 120 u043f.u043d., which read as u043du0443u043au043bu0435u043eu0442u0438u0434u043du0443u044e pefc u0435u0434u043eu0432u0430u0442u0435u043bu044cu043du043eu0441u0442u044c:;CGCGGATCCCTCAATAAAGCTTGCCTTGAGTGCTTTAAGTAGTGTGTGCCCGTCTGTTGTATGACTCTGGTAACTAGAGATCCCTCAGACCACTCTAGACGGTGTAAAAAATCTCTAGCAGTGGCGCCCGAATTCCGG 5 '- 3';;genetic marker, gene - lactamase (Ampr), u043eu043fu0440u0435u0434u0435u043bu00a0u044eu0449u0438u0439 resistance to u0430u043cu043fu0438u0446u0438u043bu043bu0438u043du0443;;unique restriction sites u0443u0437u043du0430u0432u0430u043du0438u00a0 u044du043du0434u043eu043du0443u043au043bu0435u043eu0437u0430u043cu0438 with the following coordinates: BamHI - 2 and EcoRI - 128.;2. u0440u0435u043au043eu043cu0431u0438u043du0430u043du0442u043du0430u00a0 u043fu043bu0430u0437u043cu0438u0434u043du0430u00a0 dna pBluKSM - hiv - LTR mod, u043du0435u0441u0443u0449u0430u00a0 cloned a fragment of the genome of human immunodeficiency virus type 1 from the conservative party a 5 '- LTR sequences, the size of the 3069 u043f.u043d. and u043cu043eu043bu0435u043au0443u043bu00a0u0440u043du043eu0439 mass 2 mda, u0432u043au043bu044eu0447u0430u044eu0449u0430;BamHI / EcoRI - a fragment of a vector plasmid pBluKSM [pBluescript ks (-) of Stratagene] of 2940 u043f.u043d. containing the gene for the alpha u043fu0435u043fu0442u0438u0434u0430 beta lactamase (lacZ ') - 460 - 816; site initiation promoter or t7 - u043fu043eu043bu0438u043cu0435u0440u0430u0437u044b - 643; gene resistance to u0430u043cu043fu0438u0446u0438u043bu043bu0438u043du0443 (bla) 1976 - 2833.;BamHI / EcoRI - u043au0434u043du043a modified fragment of the 5 '- LTR conservative sequences of human immunodeficiency virus type 1 size 123 u043f.u043d. with u0442u0440u0430u043du0441u043au0440u0438u0431u0438 u0440u0443u0435u043cu0443u044e u043du0443u043au043bu0435u043eu0442u0438u0434u043du0443u044e sequence;5 '- ATGCTCAATAAAGCTTGCCTTGAGTGCTTTAAGTACTCTGTCCGCGTCTCTTGTATGACTCTGG TAACTAGAGATCCCTCAGACCACTCTAGACGGTGTAAAAAATCTCTAGCAGTGGCGCCC - 3'.;unique restriction sites u0443u0437u043du0430u0432u0430u043du0438u00a0 u044du043du0434u043eu043du0443u043au043bu0435u0430u0437u0430u043cu0438 with the following coordinates: BamHI - 690 and EcoRI - 819.;3. a test set of u0434u043bu00a0 quantitative rapid identification of hiv - 1 of any type in the sample containing the following components:;designed u0430u043cu043fu043bu0438u0444u0438u043au0430u0446u0438u043eu043du043du044bu0439 primer to the conservative of the 5 '- LTR - human genome of hiv - 1 (533 - 549 HIVHXB2, GenBank sample u043aO3455) of 17 nucleotides;5 '- GCT tgc tgc CTT GAG tt - 3' (oligonucleotide).;designed u0430u043cu043fu043bu0438u0444u0438u043au0430u0446u0438u043eu043du043du044bu0439 primer to the conservative of the 5 '- LTR - human genome of hiv - 1 (630, 640) of 18 nucleotides;5 '- CGC cac tgc TAG aga ttt - 3' (oligonucleotide ii);;designed u0433u0438u0431u0440u0438u0434u0438u0437u0430u0446u0438u043eu043du043du044bu0439 probe, complementary the genome of hiv - 1 (552 - 575), located between the u043fu0440u0430u0439u043cu0435u0440u0430u043cu0438, and a 5 '- end of the u0444u043bu0443u043eu0440u0435u0441u0446u0435u043du0442u043du0443u044e a u0444u043bu0443u043eu0440u0435u0441u0446u0435u0438u043du0430 fam, and 3 '- end of u0442u0443u0448u0438u0442u0435u043bu044c u0444u043bu044eu043eu0440u0435u0441u0446u0435u043du0446u0438u0438 - u043du0435u0438u0437u043bu0443u0447u0430u044eu0449u0435u0435 connection BHQ1;5 '- fam - AGTAGTGTGTGCCCGTCTGTTGTA - BHQ1 - 3' (oligonucleotide iii);;designed u0433u0438u0431u0440u0438u0434u0438u0437u0430u0446u0438u043eu043du043du044bu0439 probe u0434u043bu00a0 u043eu043fu0440u0435u0434u0435u043bu0435u043du0438u00a0 internal standard containing the 5 '- end of fluorescent dye TAMRA and at the 3' - end u0442u0443u0448u0438u0442u0435u043bu044c u0444u043bu0443u043eu0440u0435u0441 u0446u0435u043du0446u0438u0438 BHQ2:;5 '- TAMRA - AGT act CTG shh gcg tct GTT gta - BHQ2 - 3' (oligonucleotide iv);;the cloned fragment of the genome of hiv - 1 containing a conservative site 5 '- LTR, u0434u043bu00a0 u043eu043fu0440u0435u0434u0435u043bu0435u043du0438u00a0 specificity u0433u0438u0431u0440u0438u0434u0438u0437u0430u0446u0438u043eu043du043du043eu0433u043e iii the probe to the target u043fu043eu0441u043bu0435u0434u043eu0432u0430u0442 u0435u043bu044cu043du043eu0441u0442u0438 genome of hiv - 1 and u043fu043eu0441u0442u0440u043eu0435u043du0438u00a0 calibration curve (oligonucleotide v), in the form of u0440u0435u043au043eu043cu0431u0438u043du0430u043du0442u043du043eu0439 u043fu043bu0430u0437u043cu0438u0434u043du043eu0439 dna pVar15 - hiv - LTR outlined in paragraph 1;;the cloned fragment of the genome of hiv - 1 containing modified conservative site 5 '- LTR, u0434u043bu00a0 u043eu043fu0440u0435u0434u0435u043bu0435u043du0438u00a0 specificity u0433u0438u0431u0440u0438u0434u0438u0437u0430u0446u0438u043eu043du043du043eu0433u043e probe IVu043a on u0441u043bu0435u0434u043eu0432u0430u0442u0435u043bu044cu043du043eu0441u0442u0438 u043au0434u043du043a rna u043au043eu043du0442u0440u043eu043bu00a0 and u043fu043eu0441u0442u0440u043eu0435u043du0438u00a0 calibration curve (oligonucleotide vi), in the form of u0440u0435u043au043eu043cu0431u0438u043du0430u043du0442u043du043eu0439 u043fu043bu0430u0437u043cu0438u0434u043du043eu0439 dna pBluKSM - hiv - LTR mod, as described in paragraph 2.;rna modified fragment of the conservative site 5 '- LTR of 123 u043f.u043d. (oligonucleotide vii) (an internal rna standard).;4.way to quantitatively express the identification of hiv - 1 of any type in a sample, comprising a u043au0434u043du043a hiv - 1 sample tested by u043fu0440u043eu0432u0435u0434u0435u043du0438u00a0 u043eu0434u043du043eu044du0442u0430u043fu043du043eu0439 u043fu043eu043bu0438u043cu0435u0440u0430u0437u043eu0439 chain reaction in real time using u043eu043bu0438u0433u043eu043du0443u043au043bu0435u043eu0442u0438u0434u043du044bu0445 u043fu0440u0430u0439u043cu0435u0440u043eu0432, specific for the conservative area of hiv - 1.built into the u0430u043cu043fu043bu0438u043au043eu043du043eu0432 received with marked u0433u0438u0431u0440u0438u0434u0438u0437u0430u0446u0438u043eu043du043du044bu0445 probes and the amount of viral rna using internal size standard however, u043eu0442u043bu0438u0447u0430u044eu0449u0438u0439u0441u00a0, as u043fu0440u0430u0439u043cu0435u0440u043eu0432 u0434u043bu00a0 u0430u043cu043fu043bu0438u0444u0438u043au0430u0446u0438u0438 assessed viral u043au0434u043du043a use u043eu043bu0438u0433u043eu043du0443u043au043bu0435u043eu0442u0438u0434u044b i and ii described in para.3, the complementary conservative site 5 '- LTR - human genome of hiv - 1, as u0433u0438u0431u0440u0438u0434u0438u0437u0430u0446u0438u043eu043du043du044bu0445 probes - u043eu043bu0438u0433u043eu043du0443u043au043bu0435u043eu0442u0438u0434u044b iii and iv, described in paragraph 3, with a u043du0430u043bu0438u0437 u043fu0440u043eu0432u043eu0434u00a0u0442 by u0438u0437u043cu0435u0440u0435u043du0438u00a0 u0444u043bu0443u043eu0440u0435u0441u0446u0435u043du0446u0438u0438 samples in real time, as an internal rna standard oligonucleotide vii, as described in para.3, and u0434u043bu00a0 calculation of hiv - 1 rna in the test sample using the calibration curves u0434u043bu00a0 u043eu043fu0440u0435u0434u0435u043bu0435u043du0438u00a0 u043au0434u043du043a hiv - 1 and u043eu043fu0440u0435u0434u0435u043bu0435u043du0438u00a0 u043cu0443u0442u0438u0440u043eu0432u0430u043du043du043eu0439 u043au0434u043du043a hiv - 1, u043fu043eu043bu0443u0447 u0435u043du043du044bu0435 dna plasmid pVar15 - hiv - LTR and dna plasmids pBluSK - hiv - LTR mod respectively.