Detecting HIV in a blood sample comprises providing and optionally concentrating the sample, extracting viral nucleic acids, adding the extract to PCR master mix and performing amplification and detecting the amplified viral nucleic acids

摘要

Method (A) for detecting HIV in a sample derived from blood comprises: (a) providing the sample derived from blood; (b) optionally concentrating the sample derived from blood; (c) extracting viral nucleic acids using lysis buffer, and using heated nuclease-free water for elution; (d) obtaining viral nucleic acid extracts from step (c); (e) producing a PCR master mix (I); (f) adding the viral nucleic acid extracts to the PCR master mix and performing the nucleic acid amplification; and (g) detecting the amplified viral nucleic acids, and amplified internal control nucleic acid. Method (A) for detecting HIV in a sample derived from blood comprises: (a) providing the sample derived from blood; (b) optionally concentrating the sample derived from blood; (c) extracting viral nucleic acids using lysis buffer comprising internal control nucleic acid, and using heated nuclease-free water for elution; (d) obtaining viral nucleic acid extracts from step (c); (e) producing a PCR master mix (I) comprising (i) a set of oligonucleotides, which are specific to HIV-1 nucleic acids, at least a sense primer, an antisense primer, a first probe and a second probe, and (ii) a set of oligonucleotides, which are specific for HIV-2 nucleic acids, at least a sense primer, an antisense primer and a third probe, (iii) a fourth probe, which is specific to the internal control nucleic acid, where the first, second and third probe are marked with at least a first fluorescent dye, and the fourth probe is marked with at least a second fluorescent dye that is different from the first fluorescent dye; (f) adding the viral nucleic acid extracts to the PCR master mix and performing the nucleic acid amplification; and (g) detecting the amplified viral nucleic acids, and amplified internal control nucleic acid. Independent claims are included for: (1) a method (B) for detecting HIV-1 and/or HIV-2 in a sample derived from blood, comprising the above method, where the PCR master mix (II) comprises (ia) a set of oligonucleotides specific for HIV-1-nucleic acid and for the detection of HIV-1, two pairs of sense primer and antisense primer, and at least two pairs of a first probe and a second probe, in which the nucleotide sequences of the primers and probes are derived from different conserved regions of HIV-1 genotypes, (ii) and (iii); (2) a composition (C1) for the detection of HIV-1 comprises at least two oligonucleotides comprising nucleotide sequences of SEQ ID NO.1 (aacaccaggcagctatgcaaatgtt), SEQ ID NO.2 (tgaagggtactagtagttcctgctatgtc), SEQ ID NO.3 (atcaagcagccatgcaaatgtt), SEQ ID NO.4 (comprising a fully defined 30 base pairs sequences given in the specification), SEQ ID NO.5 (aagcctcaataaagtttgccttga), SEQ ID NO.6 (gcttaagcctcaataaagctt) and SEQ ID NO.7 (gttcgggcgcaaccactgctag), preferably nucleotide pairs comprising nucleotide sequences of SEQ ID NOs.1 and 2, SEQ ID NOs.3 and 4, SEQ ID NOs.5 and 7, SEQ ID NOs.6 and 7, and at least a oligonucleotide comprising nucleotide sequences of SEQ ID NO.19 (atcatcaatgaggaagctgcagaatggga), SEQ ID NO.20 (comprising a fully defined 30 base pairs sequences given in the specification), SEQ ID NO.21 (tctggtaactagagatccctcagacc), and SEQ ID NO.22 (cctggtgtctagagatccctcagacc); (3) a composition (C2) for the detection of HIV-2 comprising oligonucleotides having nucleotide sequences of SEQ ID NO.8 (gtaggtagagcctgggtgttc) and SEQ ID NO.9 (caggcggcgactaggagagat) and an oligonucleotide having nucleotide sequence of SEQ ID NO. 23 (agacggctccacgcttgctt); (4) a composition (C3) for the detection of HIV, preferably HIV-1 and HIV-2 comprising oligonucleotides having nucleotide sequences of SEQ ID NOs. 1 to 9, and oligonucleotides having nucleotide sequences of SEQ ID NOs. 19 to 23; and (5) a test kit for detecting HIV in samples derived from blood comprising the composition (C1)-(C3), and reagents and auxiliary material for the extraction of viral nucleic acids from blood samples and/or for nucleic acid amplification.