Method of diagnosing invasive aspergillosis and oligonucleotides used in this method

摘要

In the present invention, there is disclosed a method for in vitro diagnostics of invasive aspergillosis by means of isolation and detection of Aspergillus fumigatus DNA in biological samples taken from the body of a patient, said method being characterized in that it contains the following steps: a) isolation of DNA from the clinical samples, b) preamplification of fungal DNA using primers targeting conservative parts of Aspergillus fumigatus ribosomal DNA (rDNA) genes, c) quantitative real-time PCR detection of species specific region of the internal transcribed spacer 2 (ITS2) part of rDNA genes of an Aspergillus species wherein the step c) is performed using as forward primer an oligonucleotide having at least 85 percent homology to the sequence GGCTTTGTCACCTGCTCTGTAG (SEQ ID NO.2), as reverse primer an oligonucleotide having at least 85 percent homology to the sequence CTGATCCGAGGTCAACCTTAGAAA (SEQ ID NO.3) and as a probe an oligonucleotide having at least 85% homology to a sequence selected from the group comprising CCGACACCCAACTTT û MGB (SEQ ID NO.4) wherein the reduction in homology down up to 85 percent is achieved by extension or shortening of the primers and/or the probe. There are also disclosed novel oligonucleotides intended for the use in invasive aspergillosis diagnostics.