Reaction mixture for molecular detection of potato spindle tuber viroid disease in potato tubers by employing quantitative RT-PCR

摘要

a solution to the reactive smesi for molecular detection of potato vretenovitosti potato tubers by quantitative rt-pcr, which is characterized by that contains 1.mi.l sample tested rna, 12.5.mi.l twice master mix containing a buffer, the dna polymerase, deoxyribonukleotidu, and chloride horecnatu00e9ho, 1.0.mi.l smesi reverse transcriptase inhibitors and an inhibitor of rnu00e1z, 9.3.mi.l sterile distilled water complementary reactive mixture to konecnu00e9ho volume 25.mi.l and 0.1.mi.l each primer concentration 100.mi.m and specific nucleotide sequence qrt r _ pstvd: ctt tct tcg ggt gtc ctt cc, qpcr r _ pstvd: ctc ggg agc ttc agt tgt ttc, which amplifikuju00ed fragment size of 101 bp and 1.mi.l probe pstvd concentration 30.mi.m and specific nucleotide sequence tgcgctgtcgcttcggctact,while allowing the probe znacena fluorescencnu00edm dye 6 - karboxyfluoresceinem (i) and a zhu00e1sec's use tetramethylkarboxyrhodamin (tamra)..sub..n.