KIT oligodeoxyribonucleotide primer and fluorescently labeled DNA probes to identify RNA enterovirus, rhinoviruses, hepatitis A and E from the aqueous medium by multiplex PCR

摘要

Set of oligodeoxyribonucleotide primers and fluorescently-labeled DNA probes to identify RNA enterovirus, rhinovirus, hepatitis A and E from the aqueous medium by multiplex polymerase chain reaction and having the following structure: to identify RNA rhinovirus: - direct (F1 and F2) and reverse ( R1 and R2) primers: F1: 5`-TARACCTIGCAGATGRGGC-3`F2: 5`-TTAACCGTYAICCGCCA-3`R1: 5`-GAAACACGGACACCCAAAGTAG-3`R2: 5`-ACCCAAAGTAGTCGGTCCC-3`- fluorescently-labeled DNA probes ( Z1 and Z2): Z1: FAM-CCYGCGTGGCIGCCTGC-BHQ1Z2: FAM-YIAGCCTGCGTGGCGG-BHQ1dlya RNA detection of enteroviruses A, B, C, D and poliovirus: - direct (F3) and a reverse (R3) primers: F3: 5`- CAAGIACTTCTGTTICCYCGGACIGA -3`R3: 5`- ATITITCAATTGTCAICATAAGCAGCCA -3`- fluorescently-labeled DNA probe (Z3): Z3: ROX- CCTIGGCNCCTGAIGCGGCTAATCC -BHQ2dlya detect HCV RNA A: - direct (F4) and return (R4) primers: F4: 5`- GTAGGCTACGGGTGAAACCTCTT -3'R4: 5`- CGGCGTTGAATGGTTTTTGT -3'- fluorescently-labeled DNA probe (Z4): Z4: R6G- AGGGTAACAGCGGCGGATATTGGTGAGT -BHQ2dlya detecting hepatitis E virus RNA: - direct (F5) and reverse (R5) primers: F5 5`- CGGCRGTGGTTTCTGGGGTGAC -3'R5 5`- GGGGTTGGTTGGATGAATATAGGGG -3'- fluorescently-labeled DNA probe (Z5):