Nucleic acid probes and methods for detecting clinically important fungal pathogens

摘要

Method for simultaneous detection and differentiation of different pathogenic fungal species following Candida albicans, Candida parapsilosis, Candida tropicalis, Candida krusei, Candida glabrata, Aspergillus flavus, Aspergillus versicolor, Aspergillus nidulans, Aspergillus fumigatus, and Cryptococcus neoformans in combination with one another, a single trial, including; (I) releasing, isolating and / or concentrating the nucleic acids of fungal pathogens possibly present in the sample, (ii) if need be amplifying the internal transcribed spacer region (ITS) of said nucleic acid with at least one pair of primers universal fungal, (iii) hybridizing the nucleic acids of step (i) or (ii) with the following oligonucleotide probes specific species of ITS-1, selected these probes to detect and differentiate these different pathogenic fungal species, comprising; - Candida albicans: at least one of GTCTAAACTTACAACCAATT (SEQ ID NO 1), TGTCACACCAGATTATTACT (SEQ ID NO 2) or TATCAACTTGTCACACCAGA (SEQ ID NO 3), - for Candida parapsilosis: TGCCAGAGATTAAACTCAAC (SEQ ID NO 5), - for Candida tropicalis : GGTTATAACTAAACCAAACT (SEQ ID NO 6), - for Candida krusei: GGAATATAGCATATAGTCGA (SEQ ID NO 9), - for Candida glabrata: GAGCTCGGAGAGAGACATC (SEQ ID NO 10), - for Cryptococcus neoformans: CATCTACACCTGTGAACTGT (SEQ ID NO 15), - for Aspergillus flavus GTTTACTGTACCTTAGTTGCT (SEQ ID NO 18), - for Aspergillus versicolor: CCTCTCGGGGGCGAGCC (SEQ ID NO 21), - for Aspergillus nidulans: CCGAGTGCGGCTGCCTC (SEQ ID NO 22), - for Aspergillus fumigatus: GTTGATTATCGTAATCAGT (SEQ ID NO 26), or variants of said probes, differing said variants of the sequences recited above in deletion and / or addition of one or two nucleotides at the 5 'and / or 3' of the nucleotide sequence without affecting the behavior of specific hybridization esp ECIE probe, or RNA equivalents of said probes, wherein T is replaced by U, or complementary molecules of said probes, and (iv) detecting the hybridization complexes formed in step (iii).