Oligonucleotide primers for detecting wheat fungal pathogen Blumeria graminis and method for detecting it

摘要

the application concerns the oligonukleotydu00f3w,for identifying the presence of genetic material of the pathogen fungoid blumeria graminis in considered biological material using the polymerase chain reaction or modyfikacjand.the object declaration is pair of specific primers oligonukleotydowych species for use in polymerase chain reaction or its modificationabout: lidbg17 sequences: 5 '- agccaccgatcgtgtttcatt - 3': 5 '- lidbg18 agacaggagtcgttaagactgaat - 3' complementary to the specific sequence of the genome of species blumeria graminis.the declaration also includes way of pathogen detection fungoid wheat blumeria graminis.when it comes to specific dna amplification fragment length 270 - 310 pairs in the pcr reaction using a pair of primers oligonukleotydowych.