Oligonucleotide primers for detecting wheat fungal pathogen Puccinia recondita and method for detecting it

摘要

the application concerns the oligonukleotydu00f3w,for identifying the presence of genetic material of the pathogen puccinia recondita fungoid in the biological material using the polymerase reaction or its modification.the object of the application is a pair of specific primers oligonukleotydowych species for use in polymerase chain reaction or its modificationabout: lidprl5 sequences: 5 '- acgaagccctctacgacatc - 3': 5 '- lidpr16 gtctgaggcagccatcatgt - 3' complementary to specific species of puccinia recondita genome sequence.the declaration also includes way of pathogen detection fungoid wheat puccinia recondita,when it comes to specific dna amplification fragment length 280 - 330 pairs in the pcr reaction using a pair of primers oligonukleotydowych.