Pair of oligonucleotide primers for detecting the ct2 dwarf gene and method for detecting the recessive ct2 dwarf gene in rye (Secale cereale L.) plants

摘要

The notification concerns a pair of oligonucleotide starters for the detection of the ct2 dwarf gene in harvested plants with sequences: MK61b to F1 TGTCTAAGTTGTTTCAGTGA MK64b to R4 GTTGCAAGTTCCCAAAGCCC. The report shall also include a method of detecting the presence of the ct2 dwarf gene in rye plants, in which the polymorphic DNA fragments associated with the test gene are amplified in the PCR reaction using a pair of starters, followed by the characteristic amplification product,that a pair of starters is a pair of oligonucleotide starters with sequences MK61b to F1 TGTCTAAGTTCTTTCAGTGA MK64b to R4 GTTGCAAGTTCCCAAAGCCC with a marker d508041 in the case of a pair of starters MK61b to F1 and MK64b to R4.