DNA APTAMERS BINDING CARDIAC TROPONIN I OF HUMAN

摘要

FIELD: medicine; biotechnology.;SUBSTANCE: invention refers to biotechnology and medicine, namely to a region of aptamer DNA capable of binding specifically to cardiac troponin I of a human specifically and with high affinity. Main applications of DNA-aptamers to cardiac troponin I are clinical studies, medical diagnostics of myocardial infarction, including creation of high-sensitive and highly effective systems for detecting cardiac troponin I. DNA aptamers binding cardiac troponin I are presented by single-stranded DNA. DNA aptamer TnAp2 has primary sequence 5'-GGCAGCAGGAAGACAAGACAGGCAGTGT CACGCGCTCAAGGGTGGAGGGGTCGGGG AGGTTGGTTCTGTGGTTGCTCTGT-3', selected as a result of positive selection against native cardiac troponin I and negative selection against human serum albumin, cardiac troponins C and T, myoglobin and creatine kinase MB; DNA aptamer TnAp2t1 has primary sequence 5'-AGACAAGACAGGCAGTGTCA CGCGCTCAAGGGTGGAGG GGTCGGGGAGGTTGGT-3', is selected as a result of positive selection against native cardiac troponin I and negative selection against human serum albumin, cardiac troponins C and T, myoglobin and creatine kinase MB and optimization of sequence of aptamer TnAp2; DNA aptamer TnAp2t2 has primary sequence 5'-GGCAGTGTCACGCGCTCAAGG GTGGAGGGGTCGGGGAGGT-3', is selected as a result of positive selection against native cardiac troponin I and negative selection against human serum albumin, cardiac troponins C and T, myoglobin and creatine kinase MB and optimization of sequence of aptamer TnAp2; DNA aptamer TnAp2t3 has primary sequence 5'-GCTCAAGGGTGGAGGGGTCGGGGAGGT-3', selected as a result of positive selection against native cardiac troponin I and negative selection against human serum albumin, cardiac troponins C and T, myoglobin and creatine kinase MB and optimization of sequence of aptamer TnAp2; DNA aptamer TnAp12 has primary sequence 5'-GGCAGCAGGAAGACAAGACATCGGGAGGGAG GGAGGGCAGTCTAGTCTCATGTG TTTCCATGGTTCTGTGGTTGCTCTGT-3', is selected as a result of positive selection against native cardiac troponin I and negative selection against human serum albumin, cardiac troponins C and T, myoglobin and creatine kinase MB.;EFFECT: obtained DNA aptamers have specific and high-affinity binding to human cardiac troponin I, as well as their range of products.;1 cl, 4 dwg