Irradiation-injured brain tissues can self-renew in the absence of the pivotal tumor suppressor p53 in the medaka (Oryzias latipes) embryo

摘要

This study was conducted according to The University of Tokyo Animal Experiment Enforcement Rule.We examined the effects of irradiation on developing brain in the somitogenesis period at Stages 29–30, (34–35-somite stages, 74–82 h after fertilization), when neuronal cell production and migration are in full swing, which correspond approximately to the early fetal stage of humans at ～8–15 weeks post-ovulation [17]. Embryos at Stages 29–30, (34–35-somite stages, 74–82 h after fertilization) were irradiated by 137Cs gamma-rays (10 Gy, Gammacell 3000 Elan; MDS Nordion, Ottawa, Canada) at a dose rate of 7.8 Gy/min at room temperature in a water-filled plastic tube. Cyclin-dependent kinase inhibitor 1A, p21, ap53-downstream gene, has been suggested to mediate p53-induced growth arrest triggered by DNA damage [18]. The sequence of the medaka gene encoding p21 was obtained from the Ensembl Genome Browser (http://asia.ensembl.org/index.html) database. Total RNA isolation from non-irradiated and irradiated embryos of wt and p53-deficient embryos, cDNA synthesis, and quantitative real-time qPCR were performed as described [19]. The primer pair p21 forward, 5′–CAACGTGGAGAAAACACCAG–3′, and reverse, 5′–CCATTCGTCGTTTAGCTTGG–3′, were used for quantitative real-time qPCR; and the primer pair p21 forward, 5′–ATGGCTGCTCCAAAGCGG–3′, and reverse, 5′–TCACTCGCCCGATTTCCG–3′, were used as probes for whole-mount in situ (WISH). The amplified p21 cDNA was cloned into pCR4-TOPO (Invitrogen, CA, USA), digested with Not I, and transcribed in vitro with T3 polymerase to prepare digoxigenin-labeled RNA probes for WISH. Medaka embryos at Developmental Stage 28 were anesthetized on ice, fixed in 4% (w/v) paraformaldehyde in 0.1 M phosphate buffer overnight at 0–4°C, dechorionated manually with fine tweezers and washed in PBS with 0.1% Tween20. The embryos were dehydrated in methanol and WISH was performed in accordance with the method as described [20]. Medaka embryos and hatched larvae were anesthetized on ice and fixed in 4% (w/v) paraformaldehyde in 0.1 M phosphate buffer overnight at 0–4°C, then dehydrated in an ethanol series, embedded in resin (Technovit 8100; Heraeus Kulzer, Wehrheim, Germany), and sectioned frontally into a complete series of serial sections (8-μm thick), as described [11]. The sections were Nissl stained with cresyl violet for light microscopy (BX50; Olympus, Tokyo, Japan). The spatial distribution of OT cells in irradiated and non-irradiated embryonic brains was analyzed using Voronoi tessellation [15], which is a decomposition of 2D planes into independent polygons associated with each cell. The area of each Voronoi polygon corresponds to the area occupied by a single cell, and the size of the area depends on the relationships between neighboring cells. Therefore, a statistical analysis of the polygonal areas provides morphometric information about the spatial distribution pattern of the cells. As reported previously [13], gamma-ray irradiation (10 Gy) induced neural apoptosis in the marginal area of OT within 12 h in both wt and p53-deficient embryos (Supplementary Fig. S2). The clusters of AO-positive apoptotic cells disappeared at 18 h after irradiation in the OT of the p53-deficient embryos. In contrast, they remained up to 36 h after irradiation in the irradiated wt embryos and then disappeared completely at 48 h after irradiation—at approximately Stage 34, 5 days after fertilization—while degenerating nuclei, in which were observed condensed nuclei inside the round vacuoles, remained in the retina (open arrowheads in Fig.?1D, E) and in the margin of the OT (arrowheads in Fig.?1D, F). Time course appearance of degenerating apoptotic neurons in vacuoles has been demonstrated by electron microscopic observations in our previous report [13]. These observations confirmed that vacuoles were a part of the phagosome of microglia for clearing apoptotic debris. At this time-point, few condensed nuclei were present in the vacuoles of irradiated p53-deficient embryos in the retina (open arrowheads in Fig.?1G, H) and in the OT (arrowheads in Fig.?1G, I) because their considerably reduced induction of apoptotic neurons would have been digested already. The appearance of vacuoles in p53-deficient embryos was similar with wt embryos; however, they were much smaller and fewer than those of wt embryos. These round vacuoles were never observed in non-irradiated wt embryos at Stage 34 (2 days after irradiation; 5 days after fertilization) (Fig.?1A–C). At the time of hatching (6 days after irradiation; 9 days after fertilization), the vacuoles with degenerating nuclei disappeared completely in the retina and the marginal area of the OT in the wt and p53-deficient larvae (Fig.?2). However, in the irradiated wt larvae, the laminar arrangement of the retinal neurons was obviously disorganized (red bracket in Fig.?2B), and abnormal bridging structures among the layers of retinal neurons were present (n = 3; arrows in Fi