Fungemia associated with Schizophyllum commune in Brazil

摘要

Fungi have been reported since the 1980s in patients with HIV/AIDS as primary drivers for mortality in this population [1, 2]. Schizophyllum commune is a fungus uncommonly described in humans because of the difficulties encountered in the laboratory identification of this agent [3]. This fungus is ubiquitous and grows on trees and decaying wood, being widely distributed in the environment [4]. Infection occurs by inhalation of the basidiospores, with bronchopulmonary disease and sinusitis accounting for 94% of cases. Extrapulmonary dissemination was described and the brain was the most affected organ, manifesting as brain abscess [5]. In HIV-infected patients, manifestations were related to chronic sinusitis [3, 6]. Herein, we report the first case of bloodstream infection with S. commune in an HIV-infected patient. A 49-year-old Brazilian man who had received HIV diagnosis a few days before was admitted to our hospital with mild dyspnea, chronic productive cough, weight loss, headache, and fever. The diagnosis of pulmonary tuberculosis was ascertained by direct examination of sputum samples for acid-fast bacilli (AFB) and treatment was started with rifampicin, isoniazid, ethambutol, and pyrazinamide. The patient was antiretroviral therapy (ART) na?ve, with a baseline total CD4+ lymphocyte (TCD4+) count of 106 cells/μl and an HIV viral load (VL) of 180,990 copies/ml (5.3 log10). He underwent a brain computed tomography (CT) scan and lumbar puncture (LP) due to headache and neck stiffness found on physical examination. The initial cerebrospinal fluid (CSF) analysis revealed 166 cells/mm3 (95% mononuclear), protein 71.7 mg/dl, normal glucose levels, and negative direct microscopy for fungi, AFB, or other bacteria. Cultures were negative after appropriate incubation periods. The brain CT scan revealed a hypodense lesion in the right caudate nucleus suggestive of encephalomalacia from a previous lesion. Steroids were added to the antituberculous regimen with the consideration of tuberculosis meningitis, and the patient was discharged. ART was initiated in the outpatient unit with zidovudine, lamivudine, and efavirenz. After 2 weeks, the patient was readmitted to the hospital with severe headache, disorientation, and paraparesis. A new CT scan showed several new contrast-enhancing lesions located in both cerebral hemispheres (Fig 1A), associated with mass effect. A new LP revealed an inflammatory pattern similar to that observed in the previous admission. The temporal associations of these abnormalities with ART introduction led to the presumptive diagnosis of central nervous system immune reconstitution inflammatory syndrome (CNS-IRIS). Two days after this second admission, the mycology laboratory concluded the identification of a rare fungus that had grown after 10 days in blood cultures (Bact/Alert R FA Plus) performed during the patient’s previous hospitalization. Amphotericin B deoxycholate (1 mg/kg/day) was started, but the patient’s neurological status further deteriorated and he was transferred to intensive care unit (ICU). Cotrimoxazol was also started empirically for toxoplasmosis. The thermotolerance test at 37°C with the fungus isolated from the blood culture revealed a fast-expanding, cottony white mycelium. Subcultures in potato dextrose agar (PDA) yielded after a week a cottony white colony that turned light grey (Fig 1B) with a distinctive fruity odor, which appeared as hyaline, septate, nondichotomously branching hyphae in a lactophenol cotton blue mount (Fig 1C). Since it was not possible to achieve fungal identification only with conventional mycological techniques, partial sequencing of the internal transcribed spacer (ITS) region of ribosomal DNA (rDNA) was performed using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers [7] and an annealing temperature of 58°C. Automated sequencing was done using the Sequencing Platform at Funda??o Oswaldo Cruz, Brazil [8]. Sequences were edited with Sequench