Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription.

摘要

The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.