Selecting plants, e.g. solanaceous plants resistant to potyvirus, comprises detecting the presence of mutant eIF4E protein, or its nucleic acid, and absence of the wild-type

摘要

Process of selecting plants (A) resistant to potyvirus comprising detecting the presence or absence of wild-type eIF4E protein (I) or its nucleic acid (II) and mutant eIF4E protein (Ia) or its nucleic acid (IIa), where plants are selected if (Ia) or (IIa) is detected and if (I) or (II) is absent, is new. Process of selecting plants (A) resistant to potyvirus by detecting presence or absence of wild-type eIF4E protein (I) or its nucleic acid (II) and mutant eIF4E protein (Ia) or its nucleic acid (IIa), where plants are selected if (Ia) or (IIa) is detected and if (I) or (II) is absent and where (I) includes the sequence (S1), is new. Asp-Xaa1-Xaa2-Xaa3-Xaa4-Lys-Ser-Xaa5-Gln-Xaa6-Ala-Trp-Gly-Ser-Ser-Xaa7-Arg-Xaa8-Xaa9-Tyr-Thr-Phe-Ser-Xaa10-Val-Glu-Xaa11-Phe-Trp-Xaa12-Xaa13-Tyr-Asn-Asn-Ile-His-Xaa14-Pro-Ser-Lys-Leu-Xaa15-Xaa16-Gly-Ala-Asp (S1) Xaa1-4, Xaa6-10, Xaa12, Xaa13, Xaa15 and Xaa16 = neutral amino acid; Xaa5 and Xaa14 = basic amino acid; and Xaa11 = acidic amino acid. (Ia) differs in having a substitution of neutral amino acid(s) by charged amino acids(s) and/or substitution of charged amino acid(s) by neutral amino acid(s) or amino acids with the opposite charge. Independent claims are also included for: (1) selecting plants (B) used for producing (A); (2) (Ia) and (IIa) as new compounds; (3) new oligonucleotides (18) and (19), primers for PCR amplification of eIF4E-encoding sequences; (4) a kit for selecting (A); (5) antibodies (Ab) specific for (Ia), or a fragment of it containing at least 6 amino acids; (6) non-biological process for producing plants resistant to potyvirus by introducing an allele of the eIF4E gene associated with resistance; (7) genetic construct (GC) containing at least one (IIa), or its complement or fragment of at least 10 base pairs; (8) cell transformation vector containing at least one GC; and (9) plant cells, microorganisms and plants transformed with at least one GC or the vector of (8). AAAAGCACACAGCACCAACA (18) TATTCCGACATTGCATCAAGAA (19)