The recombinant plasmid DNA PCDNA-TCI, providing for the expression TCI artificial gene in eukaryotic cells, and recombinant attenuated bacterial strains SALMONELLA ENTERITIDIS E-23 / PCDNA-TCI as a candidate for the construction of LIVE DNA vaccine against human immunodeficiency virus

摘要

1. u0440u0435u043au043eu043cu0431u0438u043du0430u043du0442u043du0430u00a0 u043fu043bu0430u0437u043cu0438u0434u043du0430u00a0 dna pcDNA - tci with u043cu043eu043bu0435u043au0443u043bu00a0u0440u043du043eu0439 mass 43103 u043au0434u0430 induced gene expression, u043eu0431u0435u0441u043fu0435u0447u0438u0432u0430u044eu0449u0430u00a0 tci containing cytotoxic t cell epi tops of hiv - 1 cells in u044du0443u043au0430u0440u0438u043eu0442 has the size 6657 u043f.u043d. and consists of the following parts:;- NheI - HindIII - vector fragment dna plasmid pcDNA 3.1-mycchislacZ (-) [] Invitrogen, the size of 5423 u043f.u043d. containing cmv promoter and the sequence of BGH poly and providing u044du043au0441u043fu0440u0435u0441 this gene tci in mammalian cells; gene resistance to u0430u043cu043fu0438u0446u0438u043bu043bu0438u043du0443 (bla) and u0440u043cu0432 1 forces for selecting and breeding target plasmid in the cells of bacteria escherichia and Salmonella;;- NheI - HindIII - fragment of 1234 u043f.u043d. containing artificial gene with kozak sequence with tci and u0438u043du0438u0446u0438u0438u0440u0443u044eu0449u0438u043c u043au043eu0434u043eu043du043eu043c atg obtained by pcr with the plasmid pet tci the use of u043eu043bu0438u0433u043eu043du0443u043au043bu0435u043eu0442u0438u0434u043du044bu0445 u043fu0440u0430u0439u043cu0435u0440u043eu0432:;the 5 '- 3' GCGGCTAGCCGCCACCATGAAAATTCGGTTAAG (33 m) lower;5 'CCCAAGCTTTCATGGTAACCCTGGTACTAGCTTGTAGCACCAGCCAAAG (49)) and a processing u0440u0435u0441u0442u0440u0438u043au0442u0430u0437u0430u043cu0438 NheI - HindIII;;genetic markers, gene of resistance to the u0430u043cu043fu0438u0446u0438u043bu043bu0438u043du0443 (bla);;unique restriction sites, NruI - 209, NheI - 896, BstEII 2089, BamHI 112, EcorI niva, HmdIII - 2130, ApaI - 2140, PstI - 3544, NarI - 3491, SmaI - 3304.;- genes, with the situation in u043fu043bu0430u0437u043cu0438u0434u0435 pcDNA - tci, tci - the beginning (896) end (2129); neo (r - the beginning (3362) end (4156), bla (5661) - the end of the beginning (furnished); BGH polyA - the beginning (2250) end (2477); pMBI - the beginning (4843) the end (55); u044du0443u043au0430u0440u0438u043eu0442u0438u0447u0435u0441u043au0438u0439 promoter cmv pr - the beginning (209) end (863).;2. a recombinant strain of bacteria u0430u0442u0442u0435u043du0443u0438u0440u043eu0432u0430u043du043du044bu0439 Salmonella enteriditis e - 23 / pcDNA - tci, u0434u0435u043fu043eu043du0438u0440u043eu0432u0430u043du043du044bu0439 research into u043au043au043c number in - 883 for delivery to cells u044du0443u043au0430u0440u0438u043eu0442 dna u0432u0430u043au0446u0438 the dna in the form of u0440u0435u043au043eu043cu0431u0438u043du0430u043du0442u043du043eu0439 u043fu043bu0430u0437u043cu0438u0434u043du043eu0439 pcDNA - tci, u0437u0430u00a0u0432u043bu0435u043du043du043eu0439 in 1, and the induction of specific u0446u0438u0442u043eu0442u043eu043au0441u0438u0447u0435u0441u043au043eu0433u043e cellular response and the defeat of hiv - 1 ant with the introduction of u0438u0442u0435u043b animals.