METHOD detection of predisposition to cancer of the genitourinary system

摘要

1. method u043eu043fu0440u0435u0434u0435u043bu0435u043du0438u00a0 predispositions to cancer u0437u0430u0431u043eu043bu0435u0432u0430u043du0438u00a0u043c urogenital system, including the study of gene GP3a, while if it u0441u043eu0447u0435u0442 u0430u043du0438u00a0 allele) - a1 and a2) - set the predisposition to cancer u0437u0430u0431u043eu043bu0435u0432u0430u043du0438u00a0u043c, including invasive and metastatic forms.;2.method u0438u0441u0441u043bu0435u0434u043eu0432u0430u043du0438u00a0 gene by dna GP3a u0432u044bu0434u0435u043bu0435u043du0438u00a0 method with an r.l.f.t...., u043eu0442u043bu0438u0447u0430u044eu0449u0438u0439u0441u00a0, gene research in dry drop blood on paper as well as u043fu0440u0430u0439u043cu0435u0440u043eu0432 u0434u043bu00a0 with an r.l.f.t.... use gctccaatgtacggggtaaa '5' and 5 'ctcctcagacctccaccttg, synthesizing a dna product of 384 nucleotide pairs, which u0440u0430u0441u0449u0435u043f u043bu00a0u044eu0442 u0440u0435u0441u0442u0440u0438u043au0442u0430u0437u043eu0439 MspI, u043eu0431u0440u0430u0437u0443u00a0 dna fragments.to identify allel) - a1 on the fragments in length of 290 and 80 nucleotide pairs and allel pl - a2 - fragments of 175, 120 and 80 nucleotide pairs.