Primers for detection of Cochliobolus sativus in cereals

摘要

Primers for the detection of Cochliobolus sativus, especially in cereals, by the PCR method, composed of COSA-F (SEQ ID: 1) TCAAGCTGACCAAATCACCTTC, COSA-R (SEQ ID: 2) CTTCTCACCAGCATCTGAATATATGA, which allows the amplification of a 570 bp pathogen fragment. The use of primer is both in phytosanitary in the early diagnosis of the pathogen, which will allow targeted choice of effective protection, and in breeding processes in the selection of gene sources.