Reaction mixture for characterization of potato genotypes using DNA with PCR method

摘要

ufeffu0159eu0161enu00ed relates to the reaction mixture for the characterisation of genotypes of potato by dna pcr method which is characterised by the fact that contains 1.mi.l sample tested dna corresponding to 200 ng of sample and reagent containing 1 in dna polymerases, nucleotide mixture, which consists of 200 .mi.m each nucleotide datp, dctp, dgtp and dttp, once polymeru00e1zovu00fd reaction buffer at a ph of 8.8 at a temperature of 25.degree.c and 10 mm tris (hydroxymetyl) aminometanu, 1.5 mm magnesium chloride, 50 mm potassium chloride and 0.1% detergent, sterile distilled water, the reaction mixture to a final volume of 25.mi.l that her material parts is always a combination of two 1.5.mi.m primers fin2up x fin2do or stferin x fin2do or fin2up x telpr specific nucleotide sequence of primers stforin: acc tcc ttc aat tgg tat ga, strevin: gag ccc cta aga tgt tct at, stforout: tca tac caa ttg aag gag gt, strevout: ata gaa cat ctt very quiet ggc tc, fin2up: gaactccctcatcacctaactca, f in2do: gaaactagagcctaacgtatgaat, telpr: ccgaattcaaccctaaccctaaaccctaaaccc.