A method for detecting mutations in the gene p.Q368X MIOTSILINA (MYOC), causes the development of primary open angle glaucoma

摘要

A method of detecting mutations p.Q368X (s.1102S T) MYOC gene, accompanied by the development of hereditary forms of primary open angle glaucoma, comprising isolating DNA from peripheral blood lymphocytes by phenol-chloroform extraction, conducting PCR with the ability to analyze the endpoint fluorescence characterized in that the amplified portion MYOC gene in the presence of two oligonucleotide sequences dye EvaGreen®: Q368X - F, GTCCAGAACTGTCATAAGATA, Q368X - R, CCAAGAATACGGGAACTG, flanking a region potentially containing p.Q368X mutation (c.1102S T) in the gene MYOC .