Serotype 2 dengue virus detection kit, serotype 3 dengue virus detection kit, and dengue virus detection kit

摘要

PROBLEM TO BE SOLVED: To provide a primer pair for dengue virus detection, probe for dengue virus detection and kit for dengue virus detection which can detect dengue virus with improved sensitivity.SOLUTION: In a primer pair for dengue virus detection, each base sequence of a forward primer and a reverse primer is represented by (a) agagcctccttcatagaagttaagaca and ccaggactccattgctccata, (b) acccggcacatctggatct and gtcaccactccatttccataaag, (c) cctatatgccgagtgtggtagaaa and ttcgcactagcattcctccat, (d) tcatggtgcaggccgatag and atcccactgccacatttcagtt, (e) atgttcgaaccagagcgtgaa and tgcttctcctctcaagcggtat, and the like.SELECTED DRAWING: Figure 3