Method for detecting Fusobacterium mortiferum by real-time PCR and primers for this detection method of F. mortiferum

摘要

The invention is a method for the specific detection of Megasphaera elsdenii in the digestive tract or poultry droppings by isolating DNA from a sample and subsequently subjecting the isolated DNA to an amplification reaction by real-time PCR with primersFusoF3: CCCACCAGCTATGCTAAGTGAGFusoR3: TGCCGTAGTGATAGCAGAGAGG.