METHOD FOR DIFFERENTIATING LEGIONELLA PNEUMOPHILA STRAINS BY MOLECULAR-GENETIC TYPING

摘要

FIELD: biotechnology.;SUBSTANCE: substance of the invention consists in the fact that from the DNA of the analyzed strain of L. pneumophila four common INDEL-genes are detected, having deletions of a certain size, namely IND- A9P84_02210, A9P84_08285, A9P84_03850 and A9P84_07165, with their subsequent amplification using constructed specific primers detecting two alternative alleles: to a gene IND- A9P84_02210 – primers TTCCCCTTATTTAAATGACACCA and AAGCATAATAGGCGGGAAGA, with length of amplified fragment 80 base pairs or 110 base pairs, to a gene IND- A9P84_08285 – primers CAGAAGACAAAGCGGAATCTG and TGAGGCCGAGTTTCTTGACT, with length of amplified fragment 62 base pairs or 74 base pairs, to a gene IND- A9P84 03850 – primers CAGGTATCTGCCACGAATCA and TGGTTGTTGTCCATTTGACTG, with length of amplified fragment 63 base pairs or 75 base pairs, to a gene IND- A9P84_07165 – primers TGGGTATTAAGCAATACGCAAG and AACAGAAACACCATTTATGCTTTG, with length of amplified fragment 84 base pairs or 96 base pairs, wherein the differentiation results are recorded visually after electrophoresis in 8 % polyacrylamide gel in the presence of a DNA molecular weight marker, wherein for each strain a unique INDEL-genotype is established on four INDEL-genes, and by comparing the detected INDEL-genotypes, the common or different origin of the analyzed strains of L. pneumophila is stated.;EFFECT: invention allows typing strains of infectious agents that are used in microbiological and molecular-genetic monitoring of L. pneumophila strains circulating in different territories for their differentiation.;3 cl, 4 tbl, 2 dwg, 3 ex