Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome

摘要

AIM:To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosisptosis-epicanthus inversus syndrome(BPES).METHODS:Thirteen patients with BPES and eight healthy family members were included in this study.All participants received routine ophthalmic examinations.The target next-generation sequencing(NGS)was performed to determine the causative mutation for this family.The silico analysis was also applied to predict the pathogenesis of identified mutations.RESULTS:All patients had severe ptosis,normal intelligence,female patients have normal fertility.Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene,c.672_701 ins GCGGCTGCCGC CGCAGCTGCTG CAGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA),carried by 13 patient but absent in all unaffected members.In silico analysis supported the pathogenic nature of this highly conserved variant.This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain,which increased the number of original polyalanine chains from 14 to 24,resulting in an extended protein.CONCLUSION:A novel FOXL2 mutation c.672_701 ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT(p.Ala234_Gly235 lins AAAAAAAAGA)was identified in a large Chinese family with BPES.This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotypecorrelations,which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.