First report of hot pepper endornavirus infecting pepper in China

摘要

Hot pepper endornavirus (HPEV), a member of the family Endornaviridae, has not been reported in China. In June 2016, about 10 of pepper (Capsicum annuum L. cultivar Guofeng) plants exhibiting mild yellowing and tip wilt symptoms on leaves were noticed in two adjacent greenhouses in Feidong County, Hefei, Anhui Province, China. One leaf of eight individually symptomatic pepper plants were pooled for virus identification using high throughput small RNA sequencing (Sela et al. 2012). Raw data of 10 million reads (18 ~ 30 nt) were analyzed and assembled. BLASTn searches of the resultant contigs to database of viral genomes in GenBank identified about 253 contigs matching to four viruses including HPEV, cucumber mosaic virus (CMV, NC_002034.1, NC_002035.1 and NC_001440.1), tobacco vein clearing virus (TVCV, NC_003378.1), and pepper cryptic virus 1 (PCV-1, NC_037096.1, NC_037095.1) with high sequence identity (95). Among them, thirty-five contigs (85 nt ~ 2289 nt) had high identities (97 ~ 99) with HPEV (KR080326). To confirm HPEV infection, RT-PCR using specific primer HPEVF (5′- CACGGCAGTAGCAAATAGCA -3′, 12508 nt– 12527 nt) and HPEVR (5′- TCCGTGTTAATTTGCGTGAA - 3′, 13034 nt–13053 nt) designed in-house showed three out of eight pepper samples were HPEV positive.