Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

摘要

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The alpha- and beta-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten beta- and 2 previously reported a-globin defects were identified. The Filipino beta-deletion represented the majority of the beta-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The beta-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c. 179G>A) and the -alpha(3.7)/alpha alpha deletion were detected in 5 patients. A novel 24-bp deletion in the alpha 2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of alpha-thalassemia with beta-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino beta-deletion was the most common gene defect observed. Homozygosity for the Filipino beta-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. (C) 2014 S. Karger AG, Basel